| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.057112 |
| Chromosome: | chromosome 1 |
| Location: | 3501344 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g022800 | FAL1 | Similar to Flagellar Associated Protein FAP159 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCACCGACAGGTCCCCTCCCCCACCTGCTGCATGTTACGTGTGTTTGC |
| Internal bar code: | GGTCTCAGCACCTTATACCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1832 |
| LEAP-Seq percent confirming: | 89.3617 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTCAAATATTCGGCCGC |
| Suggested primer 2: | ACGGACATAGGGCGCTAATG |