| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.057136 |
| Chromosome: | plastome |
| Location: | 102882 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802309 | 2716996,petG,ChreCp045 | (1 of 1) K02640 - cytochrome b6-f complex subunit 5 (petG); cytochrome b6/f complex subunit V | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCGTCCATAGAAGAAGAAAAGGTAAAACATTTTGATTGGGTTATAAA |
| Internal bar code: | TCAGTTCTTTGGGGTCGAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 228 |
| LEAP-Seq percent confirming: | 41.8605 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACTGCCGTCCTAAGTAA |
| Suggested primer 2: | AGCTAACAAATCCCCGGCAA |