Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.057165 |
Chromosome: | chromosome 2 |
Location: | 5539883 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114900 | ANK23 | Predicted protein with ankyrin repeats; (1 of 7) PF12796//PF13637 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) | 3'UTR |
Cre02.g114950 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCGCTTGCTGGCTGAACTTGTGCAAACCGCTTACCCACTCCTCAGCA |
Internal bar code: | TACTAGTCCCTTTGAAAAAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1770 |
LEAP-Seq percent confirming: | 52.7778 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACGGTACTTCGCGCAATC |
Suggested primer 2: | CATTGCCATGCACACACACA |