| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.057173 |
| Chromosome: | chromosome 6 |
| Location: | 3438618 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278101 | STD1 | Serine/threonine dehydratase; (1 of 1) 4.3.1.17 - L-serine ammonia-lyase / Serine deaminase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAATGCCGCTGATCATGCCGCCGCCCGACACAGGCACCACCAGCGCGT |
| Internal bar code: | CATAATGGTTCGGCAGGCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 961 |
| LEAP-Seq percent confirming: | 7.69231 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGAGAATTGCAGTGGGGG |
| Suggested primer 2: | TCTCCAGCTCCGCAAAGAAG |