Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.057176 |
Chromosome: | plastome |
Location: | 96666 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802305 | 2716992,ChreCp041,rpoB2 | (1 of 2) K03043 - DNA-directed RNA polymerase subunit beta (rpoB); RNA polymerase beta subunit II | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACCTCCAATACTTGAAGCACTATCAGCTAATAAATCACCCACTTCAA |
Internal bar code: | CATTTTAGCACGGTTATGTTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 468 |
LEAP-Seq percent confirming: | 78.5714 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGATGTGACGCAGCCTTGAA |
Suggested primer 2: | TCAACAGCAGCTCCATCTGG |