| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.057186 |
| Chromosome: | chromosome 16 |
| Location: | 2762131 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662200 | CYA14 | Putative adenylate cyclase; (1 of 1) 3.6.1.25//3.6.1.3 - Triphosphatase // Adenosinetriphosphatase / Triphosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTGCGACACAGGGAGCGATGGGACAGGGTAGGGGGCAGGTTGGTGAA |
| Internal bar code: | TGACCGGCTAGGTCTCGCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1477 |
| LEAP-Seq percent confirming: | 98.7179 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCTGCTCTGTGCTGTGTA |
| Suggested primer 2: | CCTTGTCAACAAACCTGCGG |