| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057249 |
| Chromosome: | mitogenome |
| Location: | 3589 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802339 | nad5,ChrepMp03,801492 | NADH dehydrogenase subunit 5; (1 of 1) K03883 - NADH-ubiquinone oxidoreductase chain 5 (ND5) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTAGGTACCAACTTGTTGTCCGGTATGTTGTTCTTCCTACCATGGGG |
| Internal bar code: | ATTTTTCGGCTTGACTGAAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 506 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCGTGACCAGAAGCATCA |
| Suggested primer 2: | TATCCGCCCTAATTCACGCC |