| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057273 |
| Chromosome: | chromosome 8 |
| Location: | 1254185 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363600 | TPT12,TPT11 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 27) PF03151 - Triose-phosphate Transporter family (TPT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAAAGCAACACTACTCAATAAAAGGTCTGTCGTGGCCAAACTAAGCTA |
| Internal bar code: | ACTCATCGCAGCTAAGTGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1058 |
| LEAP-Seq percent confirming: | 96.4286 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGTGGCAGTAGCAGTAA |
| Suggested primer 2: | GTTGTAAGGCAGGTCGGTGA |