| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.057285 |
| Chromosome: | chromosome 14 |
| Location: | 3468874 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630500 | TIE2 | (1 of 1) K15323 - tRNA-splicing endonuclease subunit Sen34 (TSEN34); tRNA-intron endonuclease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACCCGAAACATACTCTAGGTGTTAAACCCACCTTCCCGAACACGCGG |
| Internal bar code: | TGTGCAGTTGGCTTTAAGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 360 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGTTCTTTGCGGGTGTT |
| Suggested primer 2: | CGAGCGGGCTATTGTTTTCG |