| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057298 |
| Chromosome: | chromosome 14 |
| Location: | 2099831 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621600 | (1 of 1) PF15003 - HAUS augmin-like complex subunit 2 (HAUS2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGACATAGTTGCCTCTGAGCAAACTACTCGAAGCCCGACAGCTCCCGT |
| Internal bar code: | TGTCATCGTCCATCCCCACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2109 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAATGGTGCGGAAGTTGG |
| Suggested primer 2: | GCCTAACCCCTCTCTCTCCA |