| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.057324 |
| Chromosome: | chromosome 2 |
| Location: | 3885071 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101550 | MRS1 | BTB/POZ domain protein; (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTAGCCAGCCCCCGCATGGACGTTCTAACGACCTCATCGGCAGAGCGC |
| Internal bar code: | CAAGGAGCGATTGTTAAATAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2230 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAGGACTACTTGAGCGG |
| Suggested primer 2: | TCTGCATAGATTCCGCGGTC |