Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.057325 |
Chromosome: | chromosome 7 |
Location: | 3178453 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g800805 | (1 of 25) IPR001965//IPR011011//IPR013083//IPR019787 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCGCCGTGCTCCAGCGGTGCCTGCCGCCGCATCTACGGCCCCCGTAC |
Internal bar code: | GGCAGAAATCTGCTAGGAGCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 99 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACAGGGCTGGTTGGATCAC |
Suggested primer 2: | TTCTGCAACTACGCGGACTT |