Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.057403 |
Chromosome: | chromosome 16 |
Location: | 7180515 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676645 | FAP200,DRC8 | Nexin-dynein regulatory complex 8; (1 of 1) PTHR23050:SF154 - CALMODULIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCAGCAGTGCGAGCCGCGCGCGGACCCCGTCGCCCAACTAGTTGCAAA |
Internal bar code: | AGAACTCCAACAAGCTATCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 383 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCAACCTGAATGCCCCCT |
Suggested primer 2: | CCCCTTCTATCGCAGTCGTC |