| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.057457 |
| Chromosome: | chromosome 8 |
| Location: | 2628509 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g373300 | MAPKKK1 | (1 of 1) K04417 - mitogen-activated protein kinase kinase kinase 9 [EC:2.7.11.25] (MAP3K9, MLK1); Mitogen-Activated Protein Kinase Kinase Kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGACCGAGGACAGGGTATGAGGCCTGGTTCAACGTCTGATTGCCAGTG |
| Internal bar code: | AAATGGGTTTGTCCTGACAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1409 |
| LEAP-Seq percent confirming: | 19.6078 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGAGCGCTCTAGGAACG |
| Suggested primer 2: | CGCCTGTTCGTTGAATAGCG |