Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.057495 |
Chromosome: | chromosome 17 |
Location: | 2765569 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g717900 | PHC1 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 1 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCGCCTACTGCTTTGAGACCATGCTGGTCACGCCAAACAACCCCGGC |
Internal bar code: | AAGGATCCGGTCGTCGCAGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1947 |
LEAP-Seq percent confirming: | 38.6364 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTACAGAGGGCAGCAGTT |
Suggested primer 2: | CTTCAGCGATGACCAATGCG |