| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.057507 |
| Chromosome: | chromosome 8 |
| Location: | 3701469 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380201 | SHKD1 | (1 of 1) 4.2.1.10 - 3-dehydroquinate dehydratase; Putative dehydroquinate dehydratase/shikimate:NADP oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCCCGTCCTCGCGCTTCTCTCCGACCTCGGCCCTCACTTTAGAACA |
| Internal bar code: | TTGACTATTATGGAGAGGCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 223 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTAGGGCGGGAGTTTGGTG |
| Suggested primer 2: | TGTCACTCTTTGCGGTCCTC |