Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.057510 |
Chromosome: | plastome |
Location: | 171437 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802327 | 2716959,atpI,ChreCp062 | ATPase IV subunit; (1 of 1) K02108 - F-type H+-transporting ATPase subunit a (ATPF0A, atpB) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTAATTCCCAGTAATAGTGCTGACCTACAGATACTTCAGCAATTTCTA |
Internal bar code: | TGGTCAATTCGTGGCGAACAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 208 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGGCAAACTGTGAGGCTG |
Suggested primer 2: | GCACCCGCTAAAGTTGCAAA |