| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.057557 |
| Chromosome: | chromosome 9 |
| Location: | 4917527 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403182 | SPT6 | (1 of 1) K11292 - transcription elongation factor SPT6 (SUPT6H, SPT6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGGTGGGGCGGGGGAGGGTTTAAATTGGTCGGACGATGATTATGGAT |
| Internal bar code: | CCAGAGGATATGCACATTAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 89 |
| LEAP-Seq percent confirming: | 27.027 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTTGACAACACACGCAG |
| Suggested primer 2: | CACACACACACACATGCTGG |