Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.057557 |
Chromosome: | chromosome 9 |
Location: | 4917527 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403182 | SPT6 | (1 of 1) K11292 - transcription elongation factor SPT6 (SUPT6H, SPT6) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGGTGGGGCGGGGGAGGGTTTAAATTGGTCGGACGATGATTATGGAT |
Internal bar code: | CCAGAGGATATGCACATTAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 89 |
LEAP-Seq percent confirming: | 27.027 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTTTGACAACACACGCAG |
Suggested primer 2: | CACACACACACACATGCTGG |