| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.057591 |
| Chromosome: | chromosome 1 |
| Location: | 4765585 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g033091 | (1 of 1) 6.3.1.14 - Diphthine--ammonia ligase / Diphthamide synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCCTTCCACACTTGCCGCAATGACAGTACATGGCTAGTCGCGTTCCT |
| Internal bar code: | CTCTTTCTCTCAGGGAAGATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1419 |
| LEAP-Seq percent confirming: | 27.7108 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCGCCGACTAACTCGAC |
| Suggested primer 2: | CAGACCCAGCCCACCTTTAG |