| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.057616 |
| Chromosome: | chromosome 12 |
| Location: | 347069 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g495850 | HBD1 | (1 of 1) PTHR24322//PTHR24322:SF513 - FAMILY NOT NAMED // PROTEIN DHS-2, ISOFORM A; 3-hydroxybutyrate dehydrogenase | intron |
| Cre12.g801342 | (1 of 1) IPR009714 - Resistin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGTCCCAGTGGGATGTGCAAGTCAATGTTTCGACGTCCTTGTCAATG |
| Internal bar code: | TACTAAAGTTACCCTTGGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 342 |
| LEAP-Seq percent confirming: | 2.63158 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTGAGGTTGCAGAGGAG |
| Suggested primer 2: | GATTGATGTCATGGCGCCAC |