| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057690 |
| Chromosome: | chromosome 9 |
| Location: | 5593728 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g409750 | CAX2 | (1 of 3) K07300 - Ca2+:H+ antiporter (chaA, CAX); CAX family cation antiporter, membrane protein | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGCGCAGCAGCCGACGCACTAACCACCGTCACCTCCTCCTCAATACCG |
| Internal bar code: | CAAACGGCCGATGCCTTGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4003 |
| LEAP-Seq percent confirming: | 99.1228 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 114 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGCCTTACCCCTGAATG |
| Suggested primer 2: | TGCGTAGTTGTGGTCACTCC |