| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057706 |
| Chromosome: | chromosome 10 |
| Location: | 1229583 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426350 | predicted protein; (1 of 2) 5.2.1.14 - Beta-carotene isomerase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGGAATCGAGGTCAGACCACACTTCTTCAAAAGCAACTGGCTAATATA |
| Internal bar code: | CCCAGGGAAAAGCGAAGGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1465 |
| LEAP-Seq percent confirming: | 86.9565 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCGCCTCTCGTAGCTAC |
| Suggested primer 2: | CCCGTAAACAGGCAGGAAGT |