| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.057718 |
| Chromosome: | chromosome 4 |
| Location: | 3940636 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g231222 | CPN60A,CPN60 alpha | Chaperonin 60A; (1 of 1) PTHR11353:SF11 - CHAPERONIN 60 SUBUNIT ALPHA 1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGCTGCAGCAACAGCGGCAGCGGGAGTTTGCGCCCGCGTCAAGGAT |
| Internal bar code: | ATGCGGTCAAACCAGGTCCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 1.21951 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 81 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCTCTCCATCGCTCTCT |
| Suggested primer 2: | GCAATGACGGTGCAGCATAG |