| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057741 |
| Chromosome: | chromosome 1 |
| Location: | 7863996 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055424 | PIGP,GPI19 | Phosphatidylinositol N-acetylglucosaminyltransferase subunit P; (1 of 1) PF08510 - PIG-P (PIG-P) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTCTGTCTCGCGTGCCCAACGGCCAGTGCCCACTGCAACCACCCATC |
| Internal bar code: | AGGAGGCCGTTGTATAATTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 768 |
| LEAP-Seq percent confirming: | 78.5714 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTACTTCCCTCATCCTGC |
| Suggested primer 2: | AACGCACGTGAAAGAAAGCC |