Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.057805 |
Chromosome: | chromosome 16 |
Location: | 3779788 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g685929 | 3'UTR | ||
Cre16.g686285 | (1 of 21) IPR011016 - Zinc finger, RING-CH-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCACAATCACGAAGAGGGGAACCTGACTACGCTTACACAGACACGCTG |
Internal bar code: | ACTGGCATATTTCAGCCCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2116 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 86 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTAGCTGCGTGTATTGCAC |
Suggested primer 2: | TTCGAGTGAGTGACTTGGCC |