Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.057807 |
Chromosome: | chromosome 10 |
Location: | 6110176 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g462100 | (1 of 781) IPR000104 - Antifreeze protein, type I | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCCACTGCCTGCACGGGCGCCTGCTGCCCCCGTGGATTCAGACGCCA |
Internal bar code: | GTTCAGGTGATATTAGGTCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 168 |
LEAP-Seq percent confirming: | 42.3077 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTACTGCTGCTGGTGCTG |
Suggested primer 2: | CATCGCCGATCTTTGCAGTG |