Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.057875 |
Chromosome: | chromosome 2 |
Location: | 2738692 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g093750 | NRX2 | Nucleoredoxin 2; (1 of 3) K17609 - nucleoredoxin [EC:1.8.1.8] (NXN) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGCTCCTCGGCCGCAGCAGGAGCGGGGGAGGCGGCAGCTGCGGCCT |
Internal bar code: | GTAGCTGATAAGTCGTGATCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 807 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACTAGAGCGATCGTCCC |
Suggested primer 2: | CAGGATGACCAGGGTAGGGA |