| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.057879 |
| Chromosome: | chromosome 13 |
| Location: | 1410596 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572000 | TPM1,UPM2,SUMT2,COBA | Putative tetrapyrrole methylase; (1 of 1) 2.1.1.198 - 16S rRNA (cytidine(1402)-2'-O)-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCCAGCGCCGTCAAAGAGGTGAGCTCCAGGGTGGGCTCCAAACCGCG |
| Internal bar code: | AAATGTTGTAAGTCGTGAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 500 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGCTACCGCGTCTCCTTG |
| Suggested primer 2: | CTTCAGGTGAGTGAGCGTGT |