| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057937 |
| Chromosome: | chromosome 9 |
| Location: | 3665632 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397142 | ADF1,TRP15 | (1 of 6) PTHR10117 - TRANSIENT RECEPTOR POTENTIAL CHANNEL; Acid-induced Ca transient receptor channel | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAACCCACCGCACCGCCCACCCACCTTCCCCCCCAGGTCATGTACCC |
| Internal bar code: | ATATTGCTCCTAGTTTCGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 544 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTAGCGAAAACACCCCTCC |
| Suggested primer 2: | TCCGTGGCCTTCTTCAACTC |