| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.057957 |
| Chromosome: | chromosome 3 |
| Location: | 2658035 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160700 | (1 of 2) IPR000679//IPR013088 - Zinc finger, GATA-type // Zinc finger, NHR/GATA-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCATGCAAGGTAGCTTGAAGCGACCTTAAGCCTGGCCGACTTGGACTC |
| Internal bar code: | AGAGAGGCTGTTAGGTGTACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1596 |
| LEAP-Seq percent confirming: | 95.6522 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGGCTGCAGACTGGAGAT |
| Suggested primer 2: | CGGCGCTCTAGTAAGGAAGG |