Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.057959 |
Chromosome: | chromosome 7 |
Location: | 1749070 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325719 | (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCGCCTGCGTCCGGCATAACCCACAGTGCGAGTTGTTTGAGTCGGGG |
Internal bar code: | GCGGTGCAAAGTATCGTCACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 987 |
LEAP-Seq percent confirming: | 96.2963 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCGTTCGGCATCGACAAC |
Suggested primer 2: | GCAAAACAAACGCCAGCAAC |