| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.057960 |
| Chromosome: | chromosome 5 |
| Location: | 3047391 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g232004 | (1 of 1) IPR012677//IPR014720 - Nucleotide-binding alpha-beta plait domain // Double-stranded RNA-binding domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACTACTTCACTACTCATGGATGTAGCCCCCATCATTCAGTAACGACT |
| Internal bar code: | AGAATAGAGTGCATCGAACTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 155 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCCTCCACCACTTCCAC |
| Suggested primer 2: | CGGTCTTCAAGCCTTCAGGT |