| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.058009 |
| Chromosome: | chromosome 12 |
| Location: | 8916007 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545800 | ROC55,ROC11 | Rhythm Of Chloroplast 55; (1 of 24) IPR006553 - Leucine-rich repeat, cysteine-containing subtype | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAACAAGACATTTCTTATGCTCAAATGCCTCAGGTGTTGCGGTAAACA |
| Internal bar code: | GGCAGATGGCGGCCACATTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3821 |
| LEAP-Seq percent confirming: | 98.4 |
| LEAP-Seq n confirming: | 123 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 125 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTACCGCTCACCGCAATG |
| Suggested primer 2: | CTGCGGTGTGAAAGTGTGTG |