Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.058067 |
Chromosome: | chromosome 15 |
Location: | 5319574 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g734516 | RPN9 | (1 of 1) K03039 - 26S proteasome regulatory subunit N9 (PSMD13, RPN9); 26S proteasome regulatory subunit | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCTTACACCCTTCGACCCTCCGCTACTCCTTCGGGGCATCACCCCCC |
Internal bar code: | TGATACCTTATCATGGCGTCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3599 |
LEAP-Seq percent confirming: | 27.7778 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 39 |
LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTTCGATAGCTCGCTCG |
Suggested primer 2: | TCGTGTTGGTCAGGCTACAC |