| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058067 |
| Chromosome: | chromosome 15 |
| Location: | 5319574 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734516 | RPN9 | (1 of 1) K03039 - 26S proteasome regulatory subunit N9 (PSMD13, RPN9); 26S proteasome regulatory subunit | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCTTACACCCTTCGACCCTCCGCTACTCCTTCGGGGCATCACCCCCC |
| Internal bar code: | TGATACCTTATCATGGCGTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3599 |
| LEAP-Seq percent confirming: | 27.7778 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTTCGATAGCTCGCTCG |
| Suggested primer 2: | TCGTGTTGGTCAGGCTACAC |