| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058096 |
| Chromosome: | chromosome 14 |
| Location: | 225459 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609050 | RPL34A | (1 of 4) 1.4.3.3 - D-amino-acid oxidase; Putative 80S Ribosomal protein L34-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTGAGGGGACAGGCGTGCAGTGGTGGGGCACCTACCCCAGGGGCACA |
| Internal bar code: | GCCTGGTCAGGGAGGGTGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2663 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTAGAGACCTGGTAGGGC |
| Suggested primer 2: | CCTCGCCCTCAATACGTCTC |