| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058194 |
| Chromosome: | chromosome 11 |
| Location: | 2160311 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467739 | IFT54,Traf3ip1,FAP116,Dyf-11Elipsa | Intraflagellar Transport Protein 54; (1 of 1) PTHR31363:SF0 - TRAF3-INTERACTING PROTEIN 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGAGAATGGATGGTAATCAACTATAGCGGGCGCTCGTGCAGCGAAGG |
| Internal bar code: | GGCCATAAGGTGGGATTTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2680 |
| LEAP-Seq percent confirming: | 88.6364 |
| LEAP-Seq n confirming: | 78 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCAGGGTTACTGCAACTA |
| Suggested primer 2: | TAGCATGTCCCCTGCCAAAG |