| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.058205 |
| Chromosome: | chromosome 12 |
| Location: | 5345238 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528750 | RPL12 | Cytosolic 80S ribosomal protein L12; (1 of 1) K02870 - large subunit ribosomal protein L12e (RP-L12e, RPL12) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCGGGGCGTGTTGCAGCGGCAGGGAAGAGCAGCTGATGATGATCAAG |
| Internal bar code: | TTTTCCTCGATGTCTTGTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 113 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTGGGTATGCGGTTTCCT |
| Suggested primer 2: | CCACTTTCGTACGTTGCAGC |