Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.058268 |
Chromosome: | chromosome 8 |
Location: | 2628509 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g373300 | MAPKKK1 | (1 of 1) K04417 - mitogen-activated protein kinase kinase kinase 9 [EC:2.7.11.25] (MAP3K9, MLK1); Mitogen-Activated Protein Kinase Kinase Kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGACCGAGGACAGGGTATGAGGCCTGGTTCAACGTCTGATTGCCAGTG |
Internal bar code: | CTCGTTATTCAGGTTTTGGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1354 |
LEAP-Seq percent confirming: | 29.0323 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTGAGCGCTCTAGGAACG |
Suggested primer 2: | CGCCTGTTCGTTGAATAGCG |