| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.058344 |
| Chromosome: | chromosome 17 |
| Location: | 5622175 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739950 | (1 of 1) PF01612//PF13086//PF13087 - 3'-5' exonuclease (DNA_pol_A_exo1) // AAA domain (AAA_11) // AAA domain (AAA_12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCACAAGCCTGGAGTCGCAAAACCCTATTACGGGACCACCTCGCTGCG |
| Internal bar code: | ATGACATCGAGAGATTGTGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4155 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACATGACAACAAGCGTG |
| Suggested primer 2: | GTCGTGCTCACCACCTTGTA |