Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.058347 |
Chromosome: | chromosome 17 |
Location: | 2585389 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g716301 | SUM7 | Similar to Small ubiquitin-like modifier; (1 of 4) PF03171//PF11976 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy) // Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTTGCTCTGTCCGTGGTCTTTAAAGTGCTTGCGTTATTTGCTCTACTA |
Internal bar code: | CGGCGTGACTTTATATCATTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2553 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTTACCGTACAGTTGCGT |
Suggested primer 2: | AAGCTCGTCGAAGGAAAGCA |