| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.058361 |
| Chromosome: | chromosome 13 |
| Location: | 92076 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g562450 | IPB3,ITN7 | Putative Importin beta, RAN-binding protein 7%252C8; (1 of 1) PTHR10997//PTHR10997:SF18 - IMPORTIN-7, 8, 11 // D-IMPORTIN 7/RANBP7 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGCCATCGCCCGCGTCCCGCTCTGCCTGAATAGACCTATCGTTGACA |
| Internal bar code: | CACGCGGCAAGGAAGCAGGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1290 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGGATGAGGAGGTGACC |
| Suggested primer 2: | ATCGCCACCAGTACCCTAGT |