| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.058385 |
| Chromosome: | chromosome 8 |
| Location: | 2868231 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g374150 | (1 of 11) IPR011146 - HIT-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAGGCACGGGCACTGCGGTGAGCATGAGCTGGCCGTGGCCGTGAAAC |
| Internal bar code: | GTGTGGGATTTATCGTATCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 96.6667 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACCCAGCTGTACGACTT |
| Suggested primer 2: | TAAGGAAGGCAACACGCTGT |