| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.058443 |
| Chromosome: | chromosome 6 |
| Location: | 67818 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g249300 | ARP5,ARP4 | (1 of 1) K11340 - actin-like protein 6A (ACTL6A, INO80K); Actin-related protein, putative SWR-C component | 3'UTR |
| Cre06.g249350 | DMC3,DMT1A | (1 of 4) K00558 - DNA (cytosine-5)-methyltransferase 1 (DNMT1, dcm); Putative DNA methylase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCACAGACGTGCCTGTCTGTGAGCACGCCAGAACCTCTCGGGTAGGTT |
| Internal bar code: | CGGAGCGCATGTCTTGAACCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2043 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGTTGCTTGAAATGCCCA |
| Suggested primer 2: | CGCCAAATGAGATGAGCAGC |