| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.058445 |
| Chromosome: | chromosome 5 |
| Location: | 2827247 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241202 | (1 of 3) 3.4.22.53 - Calpain-2 / Milli-calpain | outside_mRNA | |
| Cre05.g241250 | (1 of 1) IPR000104//IPR000253//IPR001357 - Antifreeze protein, type I // Forkhead-associated (FHA) domain // BRCT domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGACAAGCACCTGCACGTGACCATGGCTGGGCCGCAGGGGCCTGGCA |
| Internal bar code: | TACCGTTGGGACACATACTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1325 |
| LEAP-Seq percent confirming: | 97.8723 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACCTGTCCCGCTCTTTG |
| Suggested primer 2: | TAGCAACGGCCATAGTAGCG |