Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.058451 |
Chromosome: | chromosome 6 |
Location: | 4976729 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g281450 | SRR22 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 1) 1.4.3.13//2.7.11.1 - Protein-lysine 6-oxidase / Lysyl oxidase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAACAGCAGCGCTATCAATCCCGCCACAGTATACCAGTAAATGACAT |
Internal bar code: | CTTACTTAGAGGCTGTTGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1391 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCTTCCCGCTTGTCCTGT |
Suggested primer 2: | TAGCAGGTGTGTGCATACGG |