| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.058553 |
| Chromosome: | chromosome 7 |
| Location: | 6262544 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g356600 | (1 of 1) PF08007 - Cupin superfamily protein (Cupin_4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAAGCGAGTACTCAACAAAAGAAAGTGCAGTCCCACAGCGTAAAGCA |
| Internal bar code: | GTCAAGGTGGTTAACTCGATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1649 |
| LEAP-Seq percent confirming: | 97.1429 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACTGCACACACAGACACA |
| Suggested primer 2: | CAAGAAGGGCGGCAAGTAGA |