| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058584 |
| Chromosome: | chromosome 2 |
| Location: | 3659333 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g100050 | P4H-11,PHX6,PFH11 | Prolyl 4-hydroxylase 11; (1 of 2) PTHR10869//PTHR10869:SF79 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCAACGCGCAAGCACAAAGCCGGCCGCAGATGGTACCACCTAACCCCG |
| Internal bar code: | TAAACAGCGACGTCCACCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 201 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACGGTAGAGATGCTCG |
| Suggested primer 2: | CACAACCTACCAACCCCTCC |