| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.058586 |
| Chromosome: | chromosome 11 |
| Location: | 1837910 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467450 | SOM3 | S-adenosyl-L-methionine-dependent O-methyltransferase; (1 of 4) PTHR13600//PTHR13600:SF12 - LEUCINE CARBOXYL METHYLTRANSFERASE // LEUCINE CARBOXYL METHYLTRANSFERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCACTAACCACCCATCCCCACCTACCACCCGCAATCCACTCCCCATCC |
| Internal bar code: | TTCCTGTATTGCCTGTTATCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 68 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTAGTCACTGCGGCATT |
| Suggested primer 2: | AAACCAACGAAAACGAGCGG |