| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.058598 |
| Chromosome: | chromosome 12 |
| Location: | 5476587 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g801432 | (1 of 2) PF00628//PF00665//PF09337 - PHD-finger (PHD) // Integrase core domain (rve) // His(2)-Cys(2) zinc finger (zf-H2C2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGAGGGAGAGGGCTAGGGGGGCGAGCGCTGGGGGGGCAGTGGGCTTTG |
| Internal bar code: | AAGTCTCCTGCCTCGATTTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5739 |
| LEAP-Seq percent confirming: | 43.6364 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCACCCTACCTACTCCT |
| Suggested primer 2: | CCAGGAGGCTAAGATGGTGC |