| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.058619 |
| Chromosome: | chromosome 2 |
| Location: | 494820 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076350 | ATPVB1,ATPVB | Vacuolar ATP synthase subunit B; (1 of 1) K02147 - V-type H+-transporting ATPase subunit B (ATPeV1B, ATP6B) | 5'UTR |
| Cre02.g076400 | VPS25 | Subunit of ESCRT-II complex; (1 of 1) K12189 - ESCRT-II complex subunit VPS25 (VPS25, EAP20) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACCTGAAGCCACGTTGCCGGTGTGTTATGCTTTGCTAGGAGGTTAGGG |
| Internal bar code: | TCATTGGAGGTTGGATGCCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1683 |
| LEAP-Seq percent confirming: | 87.0968 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCATATCACGCGAGACAGG |
| Suggested primer 2: | TGTGTGTCCCCACTTGCTTT |